Molecular Biology

A diagram showing how the translation of the mRNA and the synthesis of proteins is made by ribosomes.

A diagram showing translation of a mRNA and synthesis of a protein by a ribosome. (Wikimedia Commons, by LadyofHats).

This unit will introduce some classic experiments in Molecular Biology, which led to the discovery of DNA as the hereditary material, the structure of DNA, and the semi-conservative model of DNA replication. We will cover DNA replication, and how the cell uses its DNA instructions to make an RNA message, and an RNA message to make a protein. Some variations to the standard mechanisms of DNA replication, transcription and translation will also be discussed. Finally, we will cover some of the general principles of gene regulation.

During this unit, you will become familiar with the experiments of Griffith, Avery, Hershey and Chase, Chargaff, Watson, Crick, and Franklin, and Meselson and Stahl. You will be able to draw a schematic of DNA, recognize the 5’ and 3’ ends of DNA, and predict the direction in which replication will proceed. You will be able to predict the mRNA produced and the resulting protein made from a given DNA sequence. In addition, you will analyze the effects of a DNA mutation on the RNA and protein produced from that DNA. You will compare the differences in DNA replication between singled-stranded circular, double-stranded circular and double-stranded linear chromosomes.

By the end of this unit, you will understand the semi-conservative model of DNA replication and be able to outline the processes and basic components of transcription and translation. You will know how replication of large DNA genomes, small DNA genomes, and RNA genomes differs, and explore how transcription and translation differ among prokaryotes, eukaryotes, and viruses.

Finally, you will understand the different mechanisms working together to regulate the Lac operon, distinguish positive and negative regulatory mechanisms, predict the phenotype caused by different mutations within the components and regulatory features of the Lac operon, and understand the benefit to an organism of regulating genes.

Looking for something specific in this course? The Resource Index compiles links to most course resources in a single page.

« Previous | Next »

Session Overview

In this session some variations to the standard mechanisms of DNA replication, transcription and translation are discussed. The minor differences in DNA replication, transcription and translation in eukaryotes, prokaryotes, and viruses are discussed as a way to more fully understand the important processes involved in the copying and expression of genomes.

Learning Objectives

To understand how DNA replication is different for singled-stranded circular, double-stranded circular and double-stranded linear chromosomes.
To understand how replication of large DNA genomes, small DNA genomes, and RNA genomes differs.
To understand how transcription is different for prokaryotes and eukaryotes, with an emphasis on splicing in eukaryotes.
To understand how translation is different for prokaryotes and eukaryotes, with an emphasis on polycistronic messages in prokaryotes.
To understand how a virus can encode the needed proteins in a compact genome.

Session Activities

Lecture Video

Watch the lecture video excerpt

Alternative Approaches to Molecular Biology

Check Yourself

Question 1

Shown below is the genomic structure of the human β-globin gene. The numbers within the boxes indicate the length (in nucleotides) of each region. The DNA sequences corresponding to the start codon and the stop codon are indicated. Which regions are present in the initial transcript?

both check

exons close

introns close

Both introns and exons are present in the initial transcript.

Question 2

What is the length (in nucleotides) of the mature, processed β-globin mRNA?

1600 close

438 close

620 check

980 close

Question 3

The following is the sequence of a double stranded DNA molecule: 5’ ATCATGACACTATGCAAGCCGAGAAGCAACAATAGCGAAGCCCATTAA 3’ 3’ TAGTATTGTGATACGTTCGGCTCTTCGTTGTTATCGCTTCGGGTAATT 5’ This DNA can encode…

3 polypeptides: one with 7 amino acids,
one with 11, and one with 14 check

a polypeptide of 11 amino acids close

a polypeptide of 12 amino acids close

a polypeptide of 14 amino acids close

a polypeptide of 15 amino acids close

a polypeptide of 7 amino acids close

a polypeptide of 8 amino acids close

a polypeptide of 8 amino acids and another with 12 close

Session Activities

Practice Problems

Further Study

Useful Links

« Previous | Next »

Session Overview

This session will explain how DNA is replicated prior to cell division. In this process, DNA polymerase uses an original strand as a template to create a new daughter strand of DNA. Polymerization occurs in the 5’ to 3’ direction, creating a new strand that is anti-parallel to the original. Polymerization begins at a specific DNA sequence called the Origin of Replication and proceeds in two directions along both template strands. Because of the directionality of synthesis, one strand is synthesized continuously, while the other strand is synthesized in small fragments, which are then joined together by DNA ligase.

Learning Objectives

To understand the semi-conservative model of DNA replication.
To recognize the 5’ and 3’ ends of DNA and predict the direction in which replication will proceed.
To predict the sequence of a newly synthesized strand of DNA, based on the sequence of the original strand.
To identify the leading and lagging strands during replication.
To understand the function of helicase and DNA ligase and explain why they are necessary.

Session Activities

Lecture Video

Watch the lecture video excerpt

DNA Replication

Check Yourself

Below is a representation of an origin of replication and the two associated replication forks. Synthesis of new DNA occurs on both strands.

Question 1

At Fork 1, which template strand (1 or 2) is copied in a continuous manner?

Template strand 1 check

Template strand 2 close

Question 2

To which site or sites can the primer 5'-CAAGG-3' bind to initiate replication?

All Sites close

Only Site A close

Only Site B close

Only Site C close

Only Site D close

Sites A and B close

Sites B and D check

Session Activities

Help Session Video

Watch the short video of Sera Thornton explaining the numbering and labeling conventions of RNA and of proteins.

Explanation of 5’ and 3’, C terminus, and N terminus

Practice Problems

Further Study

Useful Links

« Previous | Next »

Session Overview

This session will explain early experiments in Molecular Biology. Outlined are classic experiments by Avery, Griffith, Hershey, and Chase that demonstrated DNA was the hereditary material, background on Chargaff, Watson, Crick, and Franklin and how their discoveries contributed to the discovery of the structure of DNA, and details regarding how the semi-conservative model of DNA replication was shown by Meselson and Stahl.

Learning Objectives

To understand the basic outline of the Griffith, Avery, and Hershey/Chase experiments, and how these showed that DNA was the hereditary material.
To understand the role Chargaff played in discovering the structure of DNA.
To understand the roles Watson, Crick, and Franklin played in discovering the structure of DNA.
To understand how the data obtained by Meselson and Stahl confirms the semi-conservative model of DNA replication.
To draw a schematic of DNA that highlights the double-stranded nature, the polarity of each strand with respect to the other, and the base pairing between the strands.

Session Activities

Lecture Video

Watch the lecture video excerpt

DNA Structure and Classic experiments, Excerpt 1

Check Yourself

Question 1

Cells can be fractionated into different chemical components. Both Griffith and Avery found cellular fractions that could transform non-disease causing bacteria into disease causing bacteria. In each case, the transforming fraction contained predominantly which of the following molecules?

carbohydrates close

lipids close

nucleic acid check

protein close

Although the fractions were not completely pure, the fractions that had transforming abilities were greatly enriched for nucleic acid, specifically DNA.

Question 2

What functional group is found on the 3’ end of a nucleotide?

carboxyl close

hydroxyl check

nitrogenous base close

phosphate close

Question 3

Which of the following is found in DNA but not in protein?

Carbon close

Nitrogen close

Oxygen close

Phosphorus check

Sulphur close

Session Activities

Lecture Video

Watch the lecture video excerpt

DNA Structure and Classic experiments, Excerpt 2

Check Yourself

Question 1

In density gradient centrifugation, which of the following DNA molecules will travel the farthest down the tube?

a 14N-14N duplex close

a 14N-15N duplex close

a 15N-15N duplex check

Session Activities

Practice Problems

Further Study

Useful Links

Hershey and Chase Experiment
Meselson and Stahl Experiment
“Molecular Structure of Nucleic Acids” (The original Watson and Crick paper)

« Previous | Next »

Session Overview

For this exam, you will need to know the processes of DNA replication, transcription, and translation, and how they are affected by mutations. You will also need to know how viral genetic material is replicated, mechanisms of gene regulation, and the lac operon.

Check Yourself

Exam and Solutions

« Previous | Next »

Session Overview

Cells with the same DNA can look and function differently from each other; consider a photoreceptor cell and muscle cell. The difference between these two cells is the result of differential gene expression. Some genes are transcribed and translated in all cells at about the same level, but other genes may be expressed in one cell type but not another. This session will briefly outline some general principles of gene regulation. In addition, a specific example of gene regulation in bacteria will be presented in detail.

Learning Objectives

To recall and understand the different mechanisms working together to regulate the Lac operon.
To distinguish positive and negative regulatory mechanisms.
To predict the phenotype caused by different mutations within the Lac operon.
To justify the benefit to an organism of regulating genes.

Session Activities

Lecture Video

For this session, watch the first 30 minutes of the video lecture called “Gene Regulation” by Prof. Eric Lander recorded in 2004.

Gene Regulation

Check Yourself

Question 1

What is the function of the protein encoded by the LacZ gene?

Turns glucose into ATP. close

Turns glucose into lactose. close

Turns glucose into pyruvate. close

Turns lactose into glucose and galactose. check

Question 2

When should E. coli produce beta-galactosidase?

High glucose, high lactose. close

High glucose, low lactose. close

Low glucose, high lactose. check

Low glucose, low lactose. close

Session Activities

Help Session Video

Watch the short video of Sera Thornton explaining the lac operon.

The lac operon

Practice Problems

Further Study

Useful Links

lac operon

Study Guides

Diagram of lac operon (PDF)

« Previous | Next »

Session Overview

This session will explain how the cell uses its DNA instructions to make a RNA message, and the RNA message to make a protein.

Learning Objectives

Outline the processes of transcription and translation.
List the basic components needed to successfully undergo transcription and translation.
Understand the purpose of the cell’s performing transcription and translation.
Predict RNA and protein sequences from a given gene.
Analyze the effects of a DNA mutation on the RNA and protein produced from that DNA.

Session Activities

Lecture Video

Watch the lecture video excerpt

Transcription and translation, Excerpt 1

Check Yourself

// There was an extra comma at the end of multiList array. $( function($){ var quizMulti = { multiList: [ { ques: “In what direction is RNA polymerized?”, ans: “5’ to 3’”, ansSel: [“3’ to 5’”, “3 to 5”, “N to C”], ansInfo: "" }] }; var options = { allRandom: false, Random: false, help: “”, showHTML: false, animationType: 0, showWrongAns: true, title: “Concept test 1”, }; $("#quizArea").jQuizMe(quizMulti, options); });

Session Activities

Lecture Video

Watch the lecture video excerpt

Transcription and translation, Excerpt 2

Check Yourself

Question 1

True or False: More than one codon typically encodes each amino acid.

False close

True check

Question 2

Where does translation begin, as indicated on the mRNA transcript?

promoter close

start codon check

terminator close

transcription start site close

Question 3

If the following were a complete mRNA, which codon would be recognized as the stop codon?
5' UAAUGCUGACUAGUUAAGCCCGAGCGAA-3'

UAA check

UAG close

UGA close

Session Activities

Help Session Video

Watch the short video of Sera Thornton explaining a transcription and translation question that refers to Question 2 in the practice problems below.

Browse Course Material

Course Info

Instructors

Departments

As Taught In

Level

Topics

Learning Resource Types

Fundamentals of Biology

Session Overview

Session Activities

Lecture Video

Check Yourself

Question 1

Question 2

Question 3

Session Activities

Practice Problems

Further Study

Useful Links

Session Overview

Session Activities

Lecture Video

Check Yourself

Question 1

Question 2

Session Activities

Help Session Video

Practice Problems

Further Study

Suggested topics for further study in an introductory-level Biology textbook

Useful Links

Session Overview

Session Activities

Lecture Video

Check Yourself

Question 1

Question 2

Question 3

Session Activities

Lecture Video

Check Yourself

Question 1

Session Activities

Practice Problems

Further Study

Suggested topics for further study in an introductory-level Biology textbook

Useful Links

Session Overview

Check Yourself

Exam and Solutions

Session Overview

Session Activities

Lecture Video

Check Yourself

Question 1

Question 2

Session Activities

Help Session Video

Practice Problems

Further Study

Suggested topics for further study in an introductory-level Biology textbook

Useful Links

Study Guides

Session Overview

Session Activities

Lecture Video

Check Yourself

Session Activities

Lecture Video

Check Yourself

Question 1

Question 2

Question 3

Session Activities

Help Session Video

Practice Problems

Further Study

Useful Links

Course Info