Molecular Biology

Alternative Approaches to Molecular Biology

« Previous | Next »

Session Overview

Molecbio_sess4.jpg

In this session some variations to the standard mechanisms of DNA replication, transcription and translation are discussed. The minor differences in DNA replication, transcription and translation in eukaryotes, prokaryotes, and viruses are discussed as a way to more fully understand the important processes involved in the copying and expression of genomes.

Learning Objectives

  • To understand how DNA replication is different for singled-stranded circular, double-stranded circular and double-stranded linear chromosomes.
  • To understand how replication of large DNA genomes, small DNA genomes, and RNA genomes differs.
  • To understand how transcription is different for prokaryotes and eukaryotes, with an emphasis on splicing in eukaryotes.
  • To understand how translation is different for prokaryotes and eukaryotes, with an emphasis on polycistronic messages in prokaryotes.
  • To understand how a virus can encode the needed proteins in a compact genome.

Session Activities

Lecture Video

Watch the lecture video excerpt

Check Yourself

Question 1

Shown below is the genomic structure of the human β-globin gene. The numbers within the boxes indicate the length (in nucleotides) of each region. The DNA sequences corresponding to the start codon and the stop codon are indicated. Which regions are present in the initial transcript?

both check
exons close
introns close
Check Show Solution

Both introns and exons are present in the initial transcript.

Question 2

What is the length (in nucleotides) of the mature, processed β-globin mRNA?

1600 close
438 close
620 check
980 close
Check

Question 3

The following is the sequence of a double stranded DNA molecule: 5’ ATCATGACACTATGCAAGCCGAGAAGCAACAATAGCGAAGCCCATTAA 3’ 3’ TAGTATTGTGATACGTTCGGCTCTTCGTTGTTATCGCTTCGGGTAATT 5’ This DNA can encode…

3 polypeptides: one with 7 amino acids, one with 11, and one with 14 check
a polypeptide of 11 amino acids close
a polypeptide of 12 amino acids close
a polypeptide of 14 amino acids close
a polypeptide of 15 amino acids close
a polypeptide of 7 amino acids close
a polypeptide of 8 amino acids close
a polypeptide of 8 amino acids and another with 12 close
Check

Session Activities

Practice Problems

Further Study

« Previous | Next »

Learning Resource Types

theaters Recitation Videos
assignment_turned_in Problem Sets with Solutions
grading Exams with Solutions
theaters Lecture Videos